Vliv adaptace aktivovaného kalu na biodegradaci antibiotik a akumulaci genů resistence

Ivan Karpíšek | Jitka Zachová | Dana Vejmelková | Vladimír Sýkora

Informace o článku

DOI

HISTORIE
Datum doručení: 22.5.19
Datum revize: 22.5.19
Datum akceptace: 4.6.19

AFILACE

VŠCHT Praha
Technická 5, 166 28 Praha 6
karpisei@vscht.cz
tel.: +420220443228

KLÍČOVÁ SLOVA
antibiotika; antibiotická resistence; aktivovaný kal; biologická rozložitelnost, PCCPs

KEYWORDS
antibiotics, antibiotic resistance, activated sludge, biodegradation, PCCPs

Abstrakt

Aktivovaný kal na čistírnách odpadních vod je neustále vystavován nízkým koncentracím antimikrobiálních látek a dalších léčiv. To vyvolává otázku, jak mikroorganismy k těmto látkám na čistírně odpadních vod přistupují. Zda jsou schopny se v tomto prostředí na tyto látky adaptovat, degradovat je, případně je využít jako substrát. Nebo jestli jsou tyto látky aktivovaným kalem opomíjeny.

Pro posouzení adaptace aktivovaného kalu byla využita metoda PCR pro sledování genů resistence a testy biologické rozložitelnosti. Pro testy byl využit aktivovaný kal z ČOV a kal adaptovaný v laboratorních SBR modelech při koncentracích antibiotik 500 ng∙l−1 a 500 μg∙l−1. Biologická rozložitelnost byla posuzována dle normy ČSN ISO 14593. Testované látky byly sledovány pomocí skupinového stanovení celkového anorganického uhlíku. Jako testované látky byly vybrány: benzylpenicilin, ampicilin, streptomycin, erythromycin, chloramfenikol, sulfamethoxazol a trimetoprim.

Aktivovaný kal z čistírny odpadních vod neměl vyvinutou aktivitu k biodegradaci testovaných antibiotik. Je pravděpodobné, že vysoké zatížení snadno biologicky rozložitelným substrátem a krátké zdržení odpadní vody na ČOV, vede k tomu, že mikroorganismy aktivovaného kalu nejsou nuceny tyto látky aktivně utilizovat a brání se jim pouze tvorbou obranných mechanismů pomocí genů antibiotické resistence. Nízké koncentrace antibiotik v SBR modelech vytvářely selekční tlak na mikroorganismy a podněcovaly šíření genů antibiotické resistence.

Abstract

Activated sludge in wastewater treatment plants is constantly exposed to low concentrations of antimicrobials and other drugs. This raises the question of how microorganisms approach to these substances in the sewage treatment plant. Whether they can adapt, degrade, or use antibiotics as a substrate in this environment or the activated sludge neglects these substances.

To assess the adaptation of activated sludge, the PCR method for monitoring antibiotic resistance genes and biodegradability tests were used. These tests were carried out with activated sludge from WWTP and sludge adapted in laboratory SBR models at 500 ng∙l−1 and 500 μg∙l−1 of chosen antibiotics. Their biodegradability was assessed according to ČSN ISO 14593. The tested substances were monitored by group determination of total inorganic carbon. The chosen substances were: benzylpenicillin, ampicillin, streptomycin, erythromycin, chloramphenicol, sulfamethoxazole and trimethoprim.


Activated sludge had no developed activity for biodegradation of tested antibiotics. It is likely that the high load of readily biodegradable substrate and the short retention of the wastewater at the WWTP lead to the activated sludge not being forced to actively utilize these substances and will only prevent from them by forming defence mechanisms using antibiotic resistance genes. Low concentrations of antibiotics in SBR models produced selective pressure on microorganisms and stimulated the spread of antibiotic resistance genes.

1 Úvod

Antibiotika jsou jedny z nejdůležitějších léčivých látek v moderní medicíně. Používají se k léčení bakteriálních infekcí u lidí, zvířat i rostlin. Inhibují bakteriální metabolismus a tím potlačují bakteriální růst, nebo bakteriální buňku přímo usmrcují, což vede ke snížení počtu těchto mikroorganismů (Kümmerer, 2009a). Jelikož mají antibiotika přímý účinek na mikroorganismy, tak mají silný potenciál k ovlivnění ekosystému. Vychýlení rovnováhy v přirozených mikrobiálních komunitách může mít významný vliv na životní prostředí (Kümmerer, 2009b).

Hlavním zdrojem residuí antibiotik v povrchových vodách jsou komunální odpadní vody. Jestliže antibiotika nejsou odstraněna na čistírnách odpadních vod, pronikají do povrchových vod a dále do životního prostředí, kde tyto ekosystémy mohou ovlivňovat. Vedle primárních látek mohou do životního prostředí vstupovat i jejich metabolity a další degradační produkty (hydrolýza, fotodegradace aj.), které stále mohou být biologicky aktivní a toxické. Rozložitelnost různých druhů
antibiotik je velice rozdílná od snadno biologicky rozložitelných látek podléhající úplné mineralizace jako benzylpenicillin, až po persistentní látky jako trimetoprim (Kümmerer, 2003).

Tendencí k degradaci na ČOV se antibiotika sledovaná v této práci velice liší. Betalaktamy benzylpenicilin a ampicilin nejsou obvykle na ČOV detekovány, nejspíše z toho důvodu, že betalaktamový kruh (v závislosti na pH a struktuře daného betalaktamu) podléhá hydrolýze. Peniciliny vhodné pro perorální užití, mezi které patří i ampicilin, jsou proti hydrolýze odolnější, proto jsou stabilnější i na ČOV. Betalaktamový kruh u těchto látek může být rozštěpen a tím inaktivován extracelulárními betalaktamázami, které jsou produkovány některými typy bakterií resistentních na betalaktamy. Dalším důvodem, proč tyto látky nemusí být detekovány na ČOV, by mohla být jejich problematická stanovitelnost pomocí hmotnostní spektroskopie (Kümmerer, 2009b). Z penicilinových antibiotik bývá občasně detekován na ČOV a v povrchových vodách amoxicilin v koncentracích řádově 101 ng∙l−1 (Brar, 2011). Během rozkladu betalaktamů vzniká kyselina penicilinová a penicilová. Biodegradace končí úplnou mineralizací (Kümmerer, 2009b). Betalaktamy nejsou považovány za problematické polutanty, jelikož snadno podléhají biotickému i abiotickému rozkladu. Ze všech antibiotik však pokrývají více jak 70 % celkové spotřeby, proto je nelze zcela přehlížet. Jejich vliv se může projevovat zajeména na ČOV v souvisosti s antibiotickou resistencí.

Streptomycin se vzhledem k ryhlému růstu antibiotikcé resistence již pro léčbu lidí nevyužívá. Je pouze součástí antibiotické směsi na léčbu tuberkulózy. Hojně se však využívá v zemědělství, zejména pro pěstování ovoce a pro chov ryb. Z tohoto důvodu není detekován na ČOV, ale může se sezóně vyskytovat v povrchových vodách vlivem splachu zemědělských oblastí během přívalových dešťů. Dle databáze https://toxnet.nlm.nih.gov je streptomycin z organismu obvykle vylučován v nezměněné formě a informace o biodegradaci nebyly nalezeny. Rozklad streptomycinu je navržen v práci (Shen et al., 2017), autor se v práci věnuje převážně abiotické degradaci. Jako jeden z možných metabolitů streptomycinu je streptidin (Granados and Meza Ruiz, 2005), ačkoli tato práce je zaměřená na klinické testy, nikoli na osud látky v životním prostředí.

Od použití chloramfenikolu se již v minulosti upustilo vzhledem k jeho nežádoucím účinkům na kostní dřeň a riziku vzniku aplastické anémie, přesto má v medicíně stále své místo jako léčivo poslední volby díky jeho širokospektrému účinku a velice dobré farmakokinetice. Na ČOV v Evropě z tohoto důvodu již obvykle detekován nebývá. Na základě čínské studie (Peng et al., 2006) je odstranění chloramfenikolu na ČOV pravděpodobně úplné. Biodegradace chloramfenikolu byla navržena v práci (Smith et al., 2007), probíhala skrze redukci nitroskupiny s finálním metabolitem iminochinonem.

Erythromycin dnes již nemá velké využití, jeho význam přetrval převážně jako lék na léčbu akné a je součástí antibiotických mastí. Z tohoto důvodu se však do vod může dostávat přímo bez předchozí metabolizace v organismu a znečišťovat šedé nebo i rekreační vody. Ve vodním prostředí erythromycin váže další molekulu vody a obvykle se oznažuje jako erythromycin-H2O. Přestože se erythromycin používá poměrně málo, stále ho v odpadních vodách nalézáme v koncetracích řádově 101 ng∙l−1 a na ČOV se odstraní přibližně z 30 % (Tylová et al., 2013).
Sulfamethoxazol a trimetoprim se ve většině případů předepisují v kombinaci pod obchodním názvem cotrimoxazol na léčbu zánětu močových cest, případně horních cest dýchacích. Trimetoprim je silně persistentní látka. Na ČOV je detekován v koncentracích 101–102 ng∙l−1 a v podstatě není odstraňován. V práci slovenských autorů (Birošová et al., 2014) bylo detekováno na přítoku 99 ng∙l−1 ± 11 ng∙l−1 a na odtoku 87 ng∙l−1 ± 6 ng∙l−1. V práci německých autorů (Rossmann et al., 2014) bylo stanoveno na přítoku 186 ng∙l−1, a na odtoku dokonce vyšší koncentrace 208 ng∙l−1. Trimetoprim podléhá pouze menším změnám na etherových nebo amonných funkčních skupinách (Bergh et al., 1989). Sulfamethoxazol je jedno z nejčastěji detekovaných antibiotik a obecně léčiv v životním prostředí. Sulfonamidy jsou ze všech antibiotik předepisovány z více jak 20 % a jsou vysoce odolné proti rozkladu (Kümmerer, 2009a; Brar, 2011). Degradace sulfonamidů je poměrně dobře probádána, pravděpodobně i z toho důvodu, že sulfamethoxazol má velice dobrou odezvu při stanovení hmotnostní spektrometrií. V práci (Tylová et al., 2013) bylo v České republice detekováno 550 ng∙l−1 sulfamethoxazolu na odtoku z ČOV, který byl odstraněn z cca 20 %. Sulfamethoxazol je látka, u které můžeme často pozorovat vyšší výskyt na odtoku z ČOV než na přítoku, jelikož u něj může docházet k reverzibilní oxidaci amonných skupin, které se v anoxické části mohou redukovat zpět. Během metabolizace a degradace mohou vznikat následující metabolity: N4-hydroxy-sulfamethoxazol, N4-acetyl-sulfamethoxazol, N4-nitro-sulfamethoxazol, desamino-sulfamethoxazol, 4-aminobenzensulfamethoxazol, anilin (García-Galán et al., 2008; Bonvin et al., 2012; Jiang et al., 2014).

Data o odstranění léčiv na konvenčních ČOV jsou poměrně nekonzistentní. Obecně se píše, že léčiva se na ČOV odstraní z 90–99,9 %, ale odstranitelnost různých typů léčiv se může pohybovat mezi 0–100 %. (Miège et al., 2009; Wanner et al., 2011). Účinnost odstranění se může lišit i na základě technologického uspořádání a technologických parametrů. Významnými parametry jsou například doba zdržení aktivovaného kalu nebo odpadní vody ad. Biodegradace některých léčiv lépe probíhá v přítomnosti nitrifikačních bakterií.

Odstranění těchto látek na ČOV může probíhat různými procesy: biodegradací, sorpcí, hydrolýzou aj. a nelze vždy jasně určit, který z těchto procesů se na odstranění látky podílel a jakého stupně degradace bylo dosaženo. Může vznikat široké spektrum stabilních metabolitů, které jsou stále biologicky aktivní a které není možné v dnešní době efektivně sledovat. Odstranění primární látky nemusí v některých případech přímo znamenat zlepšení stavu odpadní vody. Proto je důležité rozšiřovat informace o degradaci těchto polutantů za různých podmínek a různými metodami a ideálně tyto informace i přehledně evidovat. Sledování degradace pomocí selektivních a skupinových metod stanovení, může poskytnout velice užitečné informace o osudu těchto látek v životním prostředí i na ČOV.

Informace o biologické rozložitelnosti léčiv a dalších mikropolutantů jsou pro sledování a predikci jejich osudu v životním prostředí zcela zásadní. Hlavní faktor ovlivňující jejich stabilitu ve vodách a půdách je přítomnost a aktivita mikroorganismů se schopností rozkládat danou látku. Biodegradace může probíhat metabolickými a kometabolickými drahami. Metabolická dráha ukazuje na využití dané chemikálie jako zdroj energie, uhlíku a jiných nutrientů, zatímco kometabolizmus je spojen s náhodným rozkladem vlivem enzymu nebo kofaktoru, který je vytvářen během metabolismu jiného substrátu. V některých případech opakovaná expozice těchto látek vodním a půdním mikroorganismům může posílit jejich biodegradační aktivitu a tím urychlit nebo umožnit biologický rozklad. Dalšími faktory ovlivňujícími osud a podílejícími se na stabilitě residuí léčiv v prostředí jsou fyzikálně chemické vlastnosti farmaka a environmentální faktory (světlo, teplota, pH, roční období aj.), s nimiž se pojí důležité abiotické degradační procesy fotodegradace a hydrolýza (Barra Caracciolo et al., 2015). I když většina léčiv se z prostředí odstraní přirozenou cestou, uchovávají si pseudo-persistentní charakter, protože je do životního prostředí neustále vypouštíme (Ducey a Sapkota, 2010).

Pro charakterizaci biologické rozložitelnosti organických látek ve vodním prostředí jsou dnes platné směrnice OECD 301, 302, 303 a 308 a z nich vycházející národní normy (Kümmerer, 2009a). U nás jsou pro tyto účely nejvhodnější normy ČSN EN ISO 9888 (ZW test), ČSN ISO 14593 (HS test) a ČSN ISO 10707 (BSK test). Princip těchto metod je stejný, testovaná látka je jediným zdrojem organického uhlíku a energie pro směsnou kulturu mikroorganismů. Liší se způsobem provedení, koncentrací inokula a testované látky a analytickou koncovkou. V rámci zkoušek se vedle biodegradace testované látky sleduje i chování samotného inokula jako slepý pokus, aktivita inokula pomocí snadno rozložitelné standardní látky, inhibiční působení testované látky se stanovuje pomocí následujících skupinových stanovení organických látek: CHSKCr (chemická spotřeba kyslíku dichromanem draselným), TOC (celkový organický uhlík), TIC (celkový anorganický uhlík) a BSK (biochemická spotřeba kyslíku).

S výskytem antibiotik v životním prostředí se pojí jeden z největších problémů moderní společnosti, resistence patogenních mikroorganismů na antimikrobiální látky. Omezený počet známých mechanismů, jakým antibiotika účinkují, způsobuje relativně snadný vznik odolnosti (Brar, 2011). Známe dva způsoby selekce resistentních mikroorganismů, a to mutaci a plazmidovou resistenci. Při mutaci dochází ke vzniku buněk s náhodnou mutací DNA, díky níž se stávají necitlivé proti danému antibiotiku (Kümmerer, 2004). Plazmidová resistence je kódovaná v tzv. mobilních genetických elementech, které poskytují danému mikroorganismu evoluční výhodu. Buňky disponují mechanismy, které zajišťují přenos plazmidu do další generace (vertikální přenos). Zároveň je možné, aby se plazmidy šířily i z buňky do buňky, jelikož se vyskytují volně v cytoplazmě (horizontální přenos) (Snyder a Champness, 2007). Jeden plazmid může kódovat odolnost i proti více antibiotikům najednou a buňka může vlastnit i více mobilních genetických elementů zároveň, což umožňuje tvorbu multiresistentních kmenů (Kümmerer, 2004). Vliv plošného výskytu antibiotik v životním prostředí na tvorbu resistentních bakteriálních kmenů není objasněn, ale předpokládá se, že tvorbu odolnosti podporuje. Nasvědčuje tomu zvýšený výskyt resistentních mikroorganismů za odtoky z čistíren odpadních vod. Další problém spojený s výskytem antibiotik v životním prostředí je vliv na přirozeně se vyskytující mikroorganismy a ovlivnění mikrobiální diverzity a s ní spojený negativní vliv na samočisticí procesy a účinnost biologických čistíren odpadních vod (Escher et al., 2011). Villa-Costa (Vila-Costa et al., 2017) navrhuje 2 mechanismy, jak se mikroorganismy mohou antibiotikům bránit: biodegradaci a šíření genů antibiotické resistence. V práci byl měřen výskyt genů resistence sul1 a sul2 a degradace sulfonamidů. Z výsledků vychází, že za těchto podmínek se mikroorganismy brání nízkým koncentracím sulfonamidů šířením genů resistence a vyšším koncentracím sulfonamidů biodegradací antibiotika.

2 Metodika práce

V této práci byla sledována biologická rozložitelnost vybraných antibiotik neadaptovaným kalem odebraným z ČOV a kalem předem adaptovaným na testovanou látku v SBR laboratorních modelech a výsledky byly mezi sebou porovnány. Bylo sledováno následujících 7 antibiotik: benzylpenicillin, ampicilin, streptomycin, erythromycin, chloramfenikol, sulfamethoxazol a trimetoprim. Pro testy byly využity standardy pro mikrobiologické testy od firmy Sigma-Aldrich. Dále byly detekovány geny antibiotické resistence na peniciliny (kódující beta-laktamázy) a sulfonamidy (kódující dihydropteroát syntázu, která snižuje afinitu cílové struktury na daném enzymu k sulfonamidům).

Biologická rozložitelnost byla posuzována pomocí standardizovaného testu dle normy: ČSN ISO 14593 – Metoda stanovení anorganického uhlíku v těsně uzavřených lahvičkách (CO2 headspace test).

Zkoušená látka byla dávkována tak, aby počáteční koncentrace celkového organického uhlíku byla 20 mg∙l−1. Jako inokulum byl použit aktivovaný kal z ČOV a kal adaptovaný v laboratorních modelech. Aktivovaný kal byl dávkován tak, aby konečná koncentrace sušiny v modelu byla 4 mg∙l−1.

U každého testu byly sledovány modely pro slepý pokus, kontrolu aktivity inokula na standardní látku benzoan sodný, biodegradaci testované látky a test inhibice, který obsahoval zkoumanou sloučeninu a benzoan sodný v poměru celkového organického uhlíku 1:1. U testů s adaptovaným kalem nebyl prováděn test inhibice.

Během testů bylo postupováno s následujícími odchylkami od norem. Při přípravě minerálního média byl chlorid amonný dávkován ve formě samostatného roztoku. Inkubace probíhala v reagenčních lahvičkách o objemu 250 ml namísto 160 ml a byl zachován předepsaný poměr mezi kapalnou a plynou fází. Pro přeměnu oxidu uhličitého na uhličitany byl používán úměrně menší objem roztoku hydroxidu sodného o koncentraci 15 mol∙l−1 místo 7 mol∙l−1, z důvodu omezení rozpustnosti oxidu uhličitého v roztoku a tím snížení koncentrace TIC slepého stanovení (Macharová a Sýkora, 2007). Pro udržení rovnováhy mezi kapalnou a plynnou fází během testu byly využity magnetické míchačky namísto laboratorních třepaček. Při výpočtu stupně biologického rozkladu v čase t byla vždy od hodnoty TIC v čase t u zkoušené látky a slepého pokusu odečtena koncentrace TIC v čase 0 kvůli korekci výpočtu na skutečnou počáteční koncentraci. Stupeň biodegradace DT byl vypočítán dle rovnice 1 (Macharová a Sýkora, 2007).

 

$D_T = \frac{(TIC_{Lt} – TIC_{L0}) – (TIC_{Bt} – TIC_{B0})}{TOC_0} \cdot 100\%$ (1)

 

Kde TICLt je koncentrace anorganického uhlíku v modelu s testovanou látkou v čase t, TICL0 je koncentrace anorganického uhlíku v modelu s testovanou látkou v čase 0, TICBt je koncentrace anorganického uhlíku ve slepém pokusu v čase t, TICB0 je koncentrace anorganického uhlíku ve slepém pokusu v čase 0 a TOC0 je koncentrace organického uhlíku na počátku testu.

Hodnoty TIC byly stanoveny vždy z 3 nezávislých stanovení se směrodatnou odchylkou nižší než 2 %. Intervaly spolehlivosti naznačené na grafech chybovými úsečkami byly vyhodnoceny pomocí studentova rozdělení na 5% hladině významnosti ze dvou až tří opakování (dle výsledné směrodatné odchylky jednotlivých stanovení). V případě benzylpenicilinu, chloramfenikolu a sulfamethoxazolu byly intervaly spolehlivosti vypočítány ze všech hodnot získaných pro testy adaptovaných kalů, jelikož na základě výsledků byl vliv adaptace při obou podmínkách obdobný.

Adaptace aktivovaného kalu byla prováděna v laboratorních SBR modelech o objemu 1 l, s jednodenním cyklem, s denním přítokem 0,5 l, se zdržením aktivovaného kalu 20 dní, s denním přítokem methanolu 260 mg∙l−1∙d−1 (CHSK) a peptonu 550 mg∙l−1∙d−1 (CHSK). Pro udržení stabilního pH byl dávkován fosforečnanový tlumivý roztok. Kal byl adaptován na 2 koncentračních hladinách testovaných antibiotik. 500 μg∙l−1 a 500 ng∙l−1.

Geny resistence na antibiotika (ARG, Antibiotic Resistance Genes) byly detekovány metodou PCR. Použité primery jsou shrnuty v tabulce 1. DNA byla izolována pomocí kitu DNA PowerSoil (Qiagen).

Pufr, MgCl2, dNTP a polymeráza byly použity od firmy Roche (FastStart Taq DNA Polymerase, dNTP pack), Přidávané BSA (Sigma-Aldrich) bylo naředěno na 2 mg∙ml−1. Přidávané primery měly koncentraci 25 μmol∙l−1 a byly syntetizovány u Sigma-Aldrich (Vejmelková et al., 2018).

Multiplex metoda byla připravena zvlášť pro ARG na betalaktamy a sulfonamidy. Do PCR směsi byla přidána výše zmíněná činidla v daných objemech: 2,5 μl pufru, 1,6 μl MgCl2, 1,5 μl BSA, 0,75 μl dNTP, 0,5 μl od každého primeru a 0,3 μl polymerázy. Činidla byla přidána do vody s PCR čistotou o takovém objemu, aby konečný objem byl 24 μl. K mastermixu byl přidán vždy 1 μl roztoku izolované DNA. Směs byla po promíchání vložena do termocykleru VWR Doppio a byl spuštěn příslušný program. Součástí každé PCR byla pozitivní a negativní kontrola (Vejmelková et al., 2018).

Polycyklická reakce betalaktamáz byla prováděna za následujících podmínek:

  • Počáteční denaturace 15 minut při 95 °C
  • 30 cyklů
    • Denaturace 30 sekund při 94 °C
    • Hybridizace 30 s při 60 °C
    • Elongace 2 minuty při 72 °C
  • Finální extenze 10 minut při 72 °C (Monstein et al., 2007).

Polycyklická reakce sul1 a sul2 byla prováděna za následujících podmínek:

  • Počáteční denaturace 5 minut při 94 °C
  • 30 cyklů
    • Denaturace 40 sekund při 94 °C
    • Hybridizace 40 s při 55 °C
    • Elongace 1 minuta při 72 °C
  • Finální extenze 7 minut při 72 °C (Blahna et al., 2006).

 

Tabulka 1 Seznam použitých primerů pro PCR (upraveno dle Vejmelková et al., 2018)

Použitý pár primerů

F-primer a R-primer

Velikost PCR produktu [bp]

Citace

bla-SHV

F– 5'–ATGCGTTATATTCGCCTGTG–3'

R– 5'–TGCTTTGTTATTCGGGCCAA–3'

747

(MONSTEIN et al., 2007)

bla-TEM

F– 5'–TCGCCGCATACACTATTCTCAGAATGA–3'

R– 5'–ACGCTCACCGGCTCCAGATTTAT–3'

445

sul1

F– 5'–CTTCGATGAGAGCCGGCGGC–3'

R– 5'–GCAAGGCGGAAACCCGCGCC–3'

433

(Blahna et al., 2006)

sul2

F– 5'–GCGCTCAAGGCAGATGGCATT–3'

R– 5'–GCGTTTGATACCGGCACCCGT–3'

293

 

3 Výsledky a diskuse

Průběhy biologické rozložitelnosti testovaných antibiotik jsou shrnuty na obrázcích 1–6. V grafu je mezi sebou vždy porovnán rozklad látky vlivem neadaptovaného a adaptovaného inokula. U trimetoprimu nebyl sledován žádný viditelný biologický rozklad. Žádná z testovaných látek neměla inhibiční vliv a ověření aktivity inokula byla vždy pozitivní.

Zkouška biodegradace má dle normy ČSN ISO 14593 trvat 28 dní, z toho důvodu budou myšleny stupně biodegradace po 28 dnech testu, jestliže nebude specifikován jiný čas.

Benzylpenicilin se neadaptovaným kalem rozložil ze 70 % a adaptovanými kaly z 85 %. Biologický rozklad v obou případech započal hned na počátku testu, ale v případě adaptovaného inokula byla degradace rychlejší (14 dní), oproti neadaptovanému inokulu (21 dní). Maximální stupeň biodegradace byl v obou případech při ukončení testu po 35 dnech kolem 90 % (Obr. 1).

 

Průběh biologického rozkladu benzylpenicilinu adaptovaným a neadaptovaným kalem

Obr. 1 Průběh biologického rozkladu benzylpenicilinu adaptovaným a neadaptovaným kalem

 

Ampicilin, přestože se od benzylpenicilinu liší pouze amino skupinou, byl proti degradaci mnohem odolnější. Pozitivní vliv adaptace se projevil pouze u kalu, který byl adapatován při koncentraci ampicilinu 500 μg∙l−1, kdy se rozložil ze 70 %. V ostatních případech byl stupeň degradace kolem 25 %. U testů s adaptovaným kalem můžeme vidět již na počátku testu malý rozklad pravděpodobně způsobený sekundárním rozkladem. Oproti tomu neadaptovaný kal projevoval prvních 7 dní lagovou fázi a teprve poté započala pomalá degradace (Obr. 2).

 

Průběh biologického rozkladu ampicilinu adaptovaným a neadaptovaným kalem

Obr. 2 Průběh biologického rozkladu ampicilinu adaptovaným a neadaptovaným kalem

 

Streptomycin se vlivem neadaptovaného inokula významně nerozkládal, na počátku testu došlo k degradaci přibližně 10 % látky, která byla dále stabilní. Adaptace na obou hladinách koncentrací měla u streptomycinu podobný vliv. Byla zde pozorována 14denní lagová fáze, a pak pomalý biologický rozklad, který dosáhl ke konci testu stupeň rozkladu 30–60 % (Obr. 3).

 

Průběh biologického rozkladu streptomycinu adaptovaným a neadaptovaným kalem

Obr. 3 Průběh biologického rozkladu streptomycinu adaptovaným a neadaptovaným kalem

 

Erythromycin byl lépe rozložitelný kalem adaptovaným na nižší koncentraci antibiotika, kdy se rozložil téměř ze 40 % po 14denní lagové fázi. V ostatních případech byl pozorován pouze minimální nebo žádný rozklad (Obr. 4).

 

Průběh biologického rozkladu erythromycinu adaptovaným a neadaptovaným kalem

Obr. 4 Průběh biologického rozkladu erythromycinu adaptovaným a neadaptovaným kalem


Chloramfanikol neadaptovaným kalem rozložitelný nebyl. Adaptace inokula měla na biodegradaci silný vliv, biodegradace započala hned na začátku testu a bylo dosaženo rozkladu 80–90 % (Obr. 5).

 

Průběh biologického rozkladu chloramfenikolu adaptovaným a neadaptovaným kalem

Obr. 5 Průběh biologického rozkladu chloramfenikolu adaptovaným a neadaptovaným kalem

 

Sulfamethoxazol se na počátku testu s neadaptovaným inokulem rozložil z 5 % a dále se již nerozkládal. Oproti tomu při degradaci adaptovaným inokulem vzrostl maximální stupeň rozkladu na 20–30 % a i v tomto případě nižší koncentrace antibiotika při adaptaci byla účinnější (Obr. 6).

 

Průběh biologického rozkladu sulfamethoxazolu adaptovaným a neadaptovaným kalem

Obr. 6 Průběh biologického rozkladu sulfamethoxazolu adaptovaným a neadaptovaným kalem

 

V tabulce 2 jsou shrnuty nálezy genů resistence v modelech adaptace s koncentrací antibiotika 500 μg∙l−1 a srovnány s neadaptovaným kalem (inokulem). Gen blaTEM nebyl detekován ani v inokulu ani v žádném z modelů adaptace, oproti tomu gen sul2 byl objeven ve všech modelech. Nevymizel ani v modelu, kam nebylo dávkováno žádné antibiotikum. Na základě toho můžeme usuzovat, jak je tento typ resistence v životním prostředí běžný a stabilní. Resistence na betalaktamázy blaSHV překvapivě nebyla objevena v modelech adaptovaných na betalaktamy, ale byla pozitivní v modelech adaptovaných na erythromycin a trimetoprim. Stejně tak gen sul1 nebyl selektován vlivem sulfamethoxazolu, ale šířil se spolu s odolností na trimetoprim, který se používá v kombinaci se sulfamethoxazolem, a dokonce i spolu s resistencí na testované peniciliny a streptomycin. Tento vliv je pravděpodobně způsoben přenosem genu resistence na plazmidu, který kóduje resistenci na tato antibiotika. Proč byl gen sul1 selektován v modelech adaptovaných na peniciliny, přestože nebyly detekovány blaTEM ani blaSHV, mohlo být způsobeno například přenosem s geny, které kódují efluxní pumpy, nebo jiné geny kódující resistenci na betalaktamy, které nebyly sledovány.

 

Tabulka 2: Nálezy ARG v SBR modelech adaptace při koncentrací antibiotik 500 ng∙l−1

 

Gen resistence

Léčivo v modelu adaptace

blaTEM

blaSHV

sul1

sul2

Inokulum (NEAD)

-

+

+

+

Kontrola (bez antibiotika)

-

-

-

+

Benzylpenicilin

-

-

+

+

Ampicilin

-

-

+

+

Streptomycin

-

-

+

+

Erythromycin

-

+

-

+

Chloramfenikol

-

-

-

+

Sulfamethoxazol

-

-

-

+

Trimetoprim

-

+

+

+

 

Ve všech testech se projevil aspoň malý pozitivní vliv adaptace aktivovaného kalu na obou koncentračních hladinách na biodegradaci testovaných antibiotik. Ve většině případů nebyl rozdíl, jestliže byl aktivovaný kal adaptován na 500 ng∙l−1 nebo 500 μg∙l−1, ale v několika případech se aktivovaný kal přizpůsobil testovanému antibiotiku lépe při nižších koncentracích v SBR modelu adaptace. Přestože bude nutné doplnit výsledky i o další geny resistence a o sledování ARG v modelech adaptovaných na nižší koncentrace antibiotik, tak z dosavadních testů je evidentní, že nízké koncentrace antibiotik podporují šíření genů resistence, a to i na jiná antibiotika než ta, kterým jsou mikroorganismy vystaveny.

Další podnět, který vychází z těchto experimentů je, že aktivovaný kal z čistírny odpadních vod, přestože je neustále exponován antibiotikům a dalším léčivům, nebyl na rozklad těchto látek adaptován, nebo jeho aktivita byla k rozkladu těchto látek mnohem nižší, než tomu bylo v případě kalu adaptovaného v SBR modelech na koncentrace odpovídající výskytu na čistírnách odpadních vod (cca 102 až 103 ng∙l−1). Adaptace aktivovaného kalu na rozklad těchto látek se může lišit v závislosti na dané ČOV, použité technologii, ročním období apod., přesto bylo toto pozorování nečekané. Jeden z důvodů by mohl být, že při kontinuálním procesu, který je běžný na ČOV, má aktivovaný kal v podstatě celou dobu přístup k organickým živinám. V případě SBR modelu s jednodenním cyklem dojde k rychlému vyčerpání živin, a poté následuje několikahodinová fáze, kdy jsou mikroorganismy závislé pouze na svých zásobách a na organických látkách, které jsou hůře rozložitelné. V tento okamžik se pravděpodobně začnou rozvíjet i mechanismy k biodegradaci těchto látek. Tuto myšlenku podporují i výsledky z testů inhibice, které jsou znázorněny na obrázku 7. Na obrázku jsou graficky odděleny pouze křivky, které překročily stupeň biodegradace 50 % a pro lepší přehlednost nebyly vloženy chybové úsečky.

 

Průběhy zkoušek inhibice testovaných látek na neadaptovaný kal

Obr. 7 Průběhy zkoušek inhibice testovaných látek na neadaptovaný kal

 

Během testů inhibice se biologicky významněji rozkládal pouze benzylpenicilin. U všech ostatních látek byl sledován celkový rozklad organického uhlíku v rozmezí 40–60 %. Jelikož je do testů dávkován vedle testované látky ještě benzoan sodný v poměru 1:1 (TOC), prvotní rozklad 50 % přísluší biodegradaci benzoanu sodného a lagová fáze pro testovanou látku se posunula do doby, kdy mikroorganismy vyčerpají vlastní zásoby živin.

Výsledky testů biologické rozložitelnosti lze s účinností odstranění těchto látek na ČOV porovnávat pouze částečně a ve vhodném kontextu. Podmínky na čistírnách odpadních vod jsou hodně odlišné. Koncentrace aktivovaného kalu na ČOV je 1000krát vyšší a vyšší je i koncentrace organických látek. V aktivační nádrži jsou mnohem agresivnější enzymatické podmínky, vzhledem k většímu celkovému povrchu vloček aktivovaného kalu hraje důležitější roli i sorpce, a dále svoji roli má i fotodegradace, které bylo během testů zcela zabráněno. Na druhou stranu doba zdržení odpadní vody na ČOV je velice krátká pro efektivní biologický rozklad persistentních polutantů. Testy biodegradace dobře slouží k predikci osudu těchto látek dále v povrchových vodách, ale cílí na význam biotického působení na degradaci a snaží se potlačit abiotické vlivy.

Na základě výše zmíněných výsledků můžeme usuzovat, že na ČOV nedochází k přímé metabolizaci těchto mikropolutantů, ale mikroorganismy je přehlížejí, jelikož mají dostatek snadno rozložitelného substrátu a na tyto antibiotika se adaptují pouze šířením ARG, díky kterým se stávají odolné proti jejich negativním vlivům. Tyto mechanismy bakteriální resistence mohou způsobovat i primární rozklad antibiotik, resp. přeměnu funkčních skupin, která potlačí jejich účinek na mikroorganismy, ale v odpadní vodě pak zůstává metabolit, který stále může mít toxické účinky na životní prostředí a člověka. Bakterie se však vlivu antibiotik brání častěji pasivně tím způsobem, že pozmění cílovou strukturu na enzymu, kde se antibiotikum váže, nebo pomocí efluxních pump apod. Jestliže dochází k biodegradaci těchto látek na ČOV, tak pravděpodobně převážně kometabolizací s jiným substrátem, nebo v případě, že ČOV má velmi nízké zatížení organickým uhlíkem. Odstranění těchto látek na ČOV tedy připadá nejspíše převážně na abiotické procesy a velká část těchto mikropolutantů pravděpodobně může procházet do povrchových vod odtokem z ČOV, buď jako primární látka, nebo jako její metabolit.

ČOV jsou již delší dobu považovány za tzv. hotspoty genů resistence a tyto výsledky podporují závěry, že nízké koncentrace antibiotik na ČOV vytváří selekční tlak na mikroorganismy v aktivovaném kalu a šíření ARG. V případě, že mikroorganismy nebyly antibiotikům vystaveny (kontrolní SBR model), výskyt genů resistence se v prostředí snížil pod hladinu detekce. Pouze gen sul2 byl natolik stabilní, že se v modelu udržel a bylo možné ho detekovat.

 

4 Závěr

Z testovaných antibiotik byl neadaptovaným kalem biologicky rozložitelný pouze benzylpenicilin. Ve všech případech měla adaptace aktivovaného kalu v SBR modelech pozitivní vliv na biodegradaci testovaných látek. Vlivem adaptovaného inokula se rozkládal i ampicilin (70 %), streptomycin (50 %), erythromycin (30 %), chloramfenikol (85 %) a sulfamethoxazol (25 %). Trimetoprim rozkladu nepodléhal. Adaptace probíhala mírně efektivněji při koncentracích antibiotika 500 μg∙l−1 než při 500 ng∙l−1. Na základě klasifikace biologické rozložitelnosti můžeme podle těchto testů jako biologicky rozložitelný v životním prostředí označit pouze penicilin, dále za potenciálně biologicky rozložitelný ampicilin a chloramfenikol, jelikož se rozložily působením adaptovaného kalu aspoň z 60 %, za biologicky nerozložitelné trimetoprim, sulfamethoxazol, streptomycin, erythromycin.. Přesto lze očekávat, že všechny tyto látky, s výjimkou trimetoprimu, se v životním prostředí postupně degradují v součinnosti s abiotickou degradací. Trimetoprim je natolik stabilní, že lze očekávat jeho akumulaci v životním prostředí.

Přestože i koncentrace v řádech 102 ng·l−1 mohou umožnit mikroorganismům se na rozklad některých z těchto látek adaptovat, aktivovaný kal z čistírny odpadních vod neměl ve většině případů vyvinutou aktivitu k biodegradaci testovaných mikropolutantů. Mikroorganismy na ČOV se na antibiotika adaptovaly spíše šířením obranných mechanismů skrze geny antibiotické resistence, což můžeme vidět na pozitivních nálezech genů resistence v inokulu. Na základě porovnání testů biologického rozkladu s testy inhibice a s nálezy genů resistence, lze usuzovat, že na ČOV nejsou tyto látky pravděpodobně odstraňovány přímou metabolizací, ale na odstranění se podílí spíše abiotické procesy, nebo jsou odstraňovány kometabolizací s jinou organickou látkou. Pozitivní nálezy genů resistence v laboratorních SBR modelech potvrzují, že nízké koncentrace antibiotik kolem několika 100 ng∙L−1 podněcují selekci genů resistence a spolu s geny resistence na dané antibiotikum se mohou šířit i geny resistence na jiné látky.

5 Poděkování

Financováno z účelové podpory na specifický vysokoškolský výzkum (MŠMT č. 21-SVV/2018)

6 Literatura

Barra Caracciolo, A.; Topp, E.; Grenni, P., 2015. Pharmaceuticals in the environment: Biodegradation and effects on natural microbial communities. A review. Journal of Pharmaceutical and Biomedical Analysis 106, 25–36. https://doi.org/10.1016/j.jpba.2014.11.040

Bergh, J. J.; Breytenbach, J. C.; Wessels, P. L., 1989. Degradation of trimethoprim. Journal of Pharmaceutical Sciences 78(4), 348–350. https://doi.org/10.1002/jps.2600780418

Birošová, L.; Mackuľak, T.; Bodík, I.; Ryba, J.; Škubák, J.; Grabic, R., 2014. Pilot study of seasonal occurrence and distribution of antibiotics and drug resistant bacteria in wastewater treatment plants in Slovakia. Science of The Total Environment 490, 440–444. https://doi.org/ 10.1016/j.scitotenv.2014.05.030

Blahna, M. T.; Zalewski, C. A.; Reuer, J.; Kahlmeter, G.; Foxman, B.; Marrs, C. F., 2006. The role of horizontal gene transfer in the spread of trimethoprim–sulfamethoxazole resistance among uropathogenic Escherichia coli in Europe and Canada. Journal of Antimicrobial Chemotherapy 57(4), 666–672. https://doi.org/10.1093/jac/dkl020

Bonvin, F.; Omlin, J.; Rutler, R.; Schweizer, W. B.; Alaimo, P. J.; Strathmann, T. J.; McNeill, K.; Kohn, T., 2012. Direct photolysis of human metabolites of the antibiotic sulfamethoxazole: evidence for abiotic back-transformation. Environmental science & technology 47(13), 6746–6755. https://doi.org/10.1021/es303777k

Brar, S. K., 2011. Hazardous Materials: Types, Risks, and Control. Nova Science Publishers.

Ducey, S. B.; Sapkota, A., 2010. Presence of Pharmaceuticals and Personal Care Products in the Environment – A Concern for Human Health? 1048, 345–365. https://doi.org/10.1021/bk-2010-1048.ch017

Escher, B. I.; Baumgartner, R.; Koller, M.; Treyer, K.; Lienert, J.; McArdell, C. S., 2011. Environmental toxicology and risk assessment of pharmaceuticals from hospital wastewater. Water research 45(1), 75–92. https://doi.org/10.1016/j.watres.2010.08.019

García-Galán, M. J.; Silvia Díaz-Cruz, M.; Barceló, D., 2008. Identification and determination of metabolites and degradation products of sulfonamide antibiotics. TrAC Trends in Analytical Chemistry 27(11), 1008–1022. https://doi.org/10.1016/j.trac.2008.10.001

Granados, O.; Meza Ruiz, G., 2005. Streptidine, a metabolic derivative produced after administration of streptomycin in vivo, is vestibulotoxic in rats. Histology and histopathology. https://doi.org/10.14670/HH-20.357

Jiang, B.; Li, A.; Cui, D.; Cai, R.; Ma, F.; Wang, Y., 2014. Biodegradation and metabolic pathway of sulfamethoxazole by Pseudomonas psychrophila HA-4, a newly isolated cold-adapted sulfamethoxazole-degrading
bacterium. Applied microbiology and biotechnology 98(10), 4671–4681. https://doi.org/10.1007/s00253-013-5488-3

Kümmerer, K., 2003. Signifikance of antibiotics in the environment. Journal of Antimicrobial Chemotherapy 52, 3. https://doi.org/10.1093/jac/dkg293

Kümmerer, K., 2004. Resistance in the environment. Journal of Antimicrobial Chemotherapy 54(2), 311–320. https://doi.org/10.1093/jac/dkh325

Kümmerer, K., 2009a. Antibiotics in the aquatic environment – A review – Part I. Chemosphere 75(4), 417–434. https://doi.org/10.1016/j.chemosphere.2008.11.086

Kümmerer, K., 2009b. Antibiotics in the aquatic environment – A review – Part II. Chemosphere 75(4), 435–441.  https://doi.org/10.1016/j.chemosphere.2008.12.006

Macharová, H.; Sýkora, V., 2007. Ověření metody CO2 headspace pro hodnocení úplné biologické rozložitelnosti. Seminář o tenzidoch a detergentoch, Bojnice (SK).

Miège, C.; Choubert, J. M.; Ribeiro, L.; Eusèbe, M.; Coquery, M., 2009. Fate of pharmaceuticals and personal care products in wastewater treatment plants – Conception of a database and first results. Environmental Pollution 157(5), 1721–1726. https://doi.org/10.1016/j.envpol.2008.11.045

Monstein, H.-J.; Östholm-Balkhed, Å.; Nilsson, M. V.; Nilsson, M.; Dornbusch, K.; Nilsson, L. E., 2007. Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae.
APMIS 115(12), 1400–1408. https://doi.org/10.1111/j.1600-0463.2007.00722.x

Peng, X.; Wang, Z.; Kuang, W.; Tan, J.; Li, K., 2006. A preliminary study on the occurrence and behavior of sulfonamides, ofloxacin and chloramphenicol antimicrobials in wastewaters of two sewage treatment plants in Guangzhou, China. Science of The Total Environment 371(1), 314–322. https://doi.org/10.1016/j.scitotenv.2006.07.001

Rossmann, J.; Schubert, S.; Gurke, R.; Oertel, R.; Kirch, W., 2014. Simultaneous determination of most prescribed antibiotics in multiple urban wastewater by SPE-LC–MS/MS. Journal of Chromatography B 969, 162–170. https://doi.org/10.1016/j.jchromb.2014.08.008

Shen, Y.; Zhao, W.; Zhang, C.; Shan, Y.; Shi, J., 2017. Degradation of streptomycin in aquatic environment: kinetics, pathway, and antibacterial activity analysis. Environ. Sci. Pollut. Res. 24(16), 14337–14345. https://doi.org/10.1007/s11356-017-8978-5

Smith, A. L.; Erwin, A. L.; Kline, T.; Unrath, W. C.; Nelson, K.; Weber, A.; Howald, W. N., 2007. Chloramphenicol is a substrate for a novel nitroreductase pathway in Haemophilus influenzae. Antimicrobial agents and chemotherapy 51(8), 2820–2829.

Snyder, L.; Champness, W., 2007. Molecular Genetics of Bacteria. ASM Press.

Tylová, T.; Flieger, M.; Olšovská, J., 2013. Determination of antibiotics in influents and effluents of wastewater-treatment-plants in the Czech Republic – development and application of the SPE and a UHPLC- ToFMS method. Analytical Methods 5(8), 2110–2118. https://doi.org/10.1039/C3AY00048F

Vejmelková, D.; Časarová, K.; Proksová, E.; Říhová Ambrožová, J., 2018. Detekce genů resistence na antibiotika na čistírně odpadních vod: Testování metodiky. Vodárenská biologie 2018, Praha, 6.–7. 2. 2018.

Vila-Costa, M.; Gioia, R.; Aceña, J.; Pérez, S.; Casamayor, E. O.; Dachs, J., 2017. Degradation of sulfonamides as a microbial resistance mechanism. Water research 115, 309–317. https://doi.org/10.1016/j.watres.2017.03.007

Wanner, F.; Vana, M.; Fuksa, J. K.; Matousova, L., 2011. Removal of selected pharmaceuticals during wastewater treatment in wastewater treatment plants. Vodni Hospodářství 61(9), 361–363.